Article Figures & Tables
Figures
- Figure 1
Timeline of animal experiments. Behavioural tests (MBT, OFT, SPT, TST, FST) and CVMS protocol with midday (SHAKE, REST, TILT, DARK, WD) and overnight (WET, SI, GH) stressors. CVMS = chronic variable mild stress; DARK = dark room exposure; FST = forced swim test; GH = group holding; MBT = marble burying test; OFT = open field test; REST = restraint stress; SHAKE = shaker stress; SI = social isolation; SPT = sucrose preference test; TILT = tilted cage; TST = tail suspension test; WD = water deprivation; WET = wet bedding.
- Figure 2
Representative images of Trpa1 mRNA–expressing urocortinergic cells from the mouse Edinger–Westphal nucleus. (A) Sections were counterstained with DAPI (blue) for nuclei. (B) Trpa1 mRNA (red) was visualized by RNAscope. (C) The UCN1 peptide (white) was detected by immunofluorescence (IHC). (D) Note the colocalization of Trpa1 mRNA and UCN1 peptide. DAPI = 4′,6-diamidino-2-phenylindole; IHC = immunohistochemistry; UCN1 = urocortin 1.
- Figure 3
Findings from behavioural assessments. (A) To assess anxiety levels, we calculated the number of hidden marbles in the marble burying test. (B) We evaluated the ratio of time spent in the peripheral part of the arena in the open field test. (C) To reveal locomotor effects, we evaluated distance travelled during the open field test. (D) We determined anhedonia levels with the sucrose preference test. (E and F) We evaluated depression-like behaviour as immobility time in the tail suspension test and the forced swim test. Two-way analysis of variance followed by a Fisher post hoc test: *p < 0.05, ***p < 0.001. n = 14–16 per group. Grey bars represent wild-type mice; black bars represent Trpa1 knockout mice. CVMS = chronic variable mild stress.
- Figure 4
Efficacy of exposure to CVMS. We assessed the activity of the hypothalamic–pituitary–adrenal axis by determining (A) serum ACTH and (B) corticosterone titres. We found that (C) relative total adrenal weight, (D) relative thymus weight and (E) body weight change mirrored somatic changes induced by chronic stress. (F) Absolute body weight of mice at end of the in vivo experiment. Two-way analysis of variance followed by a Fisher post hoc test: *p < 0.05; **p < 0.01; ***p < 0.001. n = 14–16 per group. Grey bars represent wild-type mice; black bars represent Trpa1 knockout mice. ACTH = adrenocorticotropic hormone; CVMS = chronic variable mild stress.
- Figure 5
Trpa1, Ucn1 mRNA and UCN1 peptide expression in EWcp neurons upon CVMS. (A and B) Trpa1 mRNA (red) was downregulated in wild-type mice exposed to CVMS, as also shown in (C) the histogram. (A′ and B′) Trpa1 mRNA transcripts (red) were localized to cells containing UCN1 peptide (white). (D to H) Ucn1 mRNA (green) was expressed at higher levels in control Trpa1 knockout mice (black bars). CVMS increased Ucn1 mRNA expression in wild-type mice only (grey bars). (I to M) UCN1 peptide content (white) of EWcp neurons. The UCN1 peptide SSD was elevated in Trpa1 knockout mice upon exposure to CVMS. DAPI (blue) labelling was performed to mark the nuclei of cells. #p < 0.05 in a Student t test. *p < 0.05, Fisher post hoc test following 2-way analysis of variance. CVMS = chronic variable mild stress; DAPI = 4′,6-diamidino-2-phenylindole; EWcp = centrally projecting division of the Edinger–Westphal nucleus; SSD = specific signal density; UCN1 = urocortin 1.
- Figure 6
Electrophoretograms of RT-PCR products. We studied 3 human EWcp samples (1 to 3) and used a TRPA1-expressing human oral squamous cell carcinoma culture (PECA) as a positive control. The housekeeping gene (DNA-directed RNA polymerase II subunit RPB1; POLR2A, size 152 bp) and the gene of interest (TRPA1, size 115 bp) were expressed in all samples, including the PECA cell culture. The UCN1 (size 123 bp) RT-PCR products proved that all brain samples contained the EWcp area. We also used a no reverse transcription control and a no template control. EWcp = centrally projecting Edinger–Westphal nucleus; no RT = no reverse transcription control; NTC = no template control; PECA = human oral squamous cell carcinoma cell line ( PE/CAPJ41; clone D2); RT-PCR = reverse transcription polymerase chain reaction; TRPA1 = transient receptor potential ankyrin 1; UCN1 = urocortin 1.
- Figure 7
Relative TRPA1 gene expression in human centrally projecting Edinger–Westphal nucleus samples from male controls (n = 3) and people who died by suicide (n = 3) as determined by Taq-Man quantitative reverse transcription polymerase chain reaction (*p < 0.05; Student t test).
Tables
Case Sex Age (yr) RIN Cause of death 1 Male 55 6.6 Acute myocardial infarction 2 Male 74 6.1 Acute heart failure 3 Male 65 6.2 Acute heart failure RIN = RNA integrity number.
Gene amplified Nucleotide sequence of primer Primer type Product length (bp) NCBI reference sequence Hs TRPA1 TCCTCTCCATCTGGCAGCAAAG Forward 115 NM_007332.3 GGACGCATGATGCAAAGCTGTC Reverse Hs POLR2A GAGAGCGTTGAGTTCCAGAACC Forward 152 NM_000937.5 TGGATGTGTGCGTTGCTCAGCA Reverse Hs UCN1 CTTCTCTGTCCATTGACCTCACC Forward 123 NM_003353.4 ATCACTTGCCCACCGAGTCGAA Reverse Mm Trpa1 ATCCAAATAGACCCAGGCACG Forward 101 NM_177781.5 CAAGCATGTGTCAATGTTTGGTACT Reverse Mm Actb CTGTATGCCTCTGGTCGTAC Forward 214 NM_007393.5 TGATGTCACGCACGATTTCC Reverse Mm Gapdh TTCACCACCATGGAGAAGGC Forward 237 NM_008084.3 GGCATGGACTGTGGTCATGA Reverse Hs = Homo sapiens; Mm = Mus musculus; NCBI = National Center for Biotechnology Information; RT-PCR = reverse transcription polymerase chain reaction.
- Table 3
Characteristics of human controls and people who died by suicide from whom brain samples were taken
Case Sex Age (yr) RIN Cause of death Post mortem time (h) 1 Male 55 6.7 Acute myocardial infarction 1 2 Male 37 6.1 Accidental electric shock 8 3 Male 81 6.0 Acute heart failure 5 4 Male 31 6.2 Suicide 8 5 Male 41 6.5 Suicide 4 6 Male 49 6.1 Suicide 4.5 RIN = RNA integrity number.
Variable CVMS Genotype CVMS × genotype F1,56 p value F1,56 p value F1,56 p value Marble burying test, marbles buried 178.9 < 0.001 4.81 0.03 0.04 0.82 Open field test, periphery distance 14.81 < 0.001 1.20 0.27 23.29 < 0.001 Open field test, periphery time 10.52 0.002 42.31 < 0.001 33.18 < 0.001 Sucrose preference test, sucrose preference 15.70 < 0.001 0.01 0.97 0.03 0.87 Tail suspension test, immobility 15.74 < 0.001 3.01 0.08 0.16 0.68 Forced swim test, immobility 15.23 < 0.001 0.66 0.42 7.4 0.01 Plasma ACTH 2.75 0.11 0.23 0.63 11.63 0.004 Plasma corticosterone 5.00 0.03 0.09 0.92 0.01 0.90 Relative adrenal weight 113.84 < 0.001 9.13 0.03 4.46 0.039 Relative thymus weight 7.31 0.009 24.59 < 0.001 15.79 0.002 Change in body weight 100.85 < 0.001 4.71 0.03 3.72 0.06 Body weight 11.68 0.001 4.53 0.037 1.003 0.32 Ucn1 mRNA 5.30 0.02 4.5 0.04 0.43 0.51 UCN1 peptide 0.94 0.34 0.45 0.50 5.22 0.03 ACTH = adrenocorticotropic hormone; CVMS = chronic variable mild stress; UCN1 = urocortin 1.
In this issue
Article tools
Related Articles
Cited By...
- No citing articles found.